Prev. |  KEGG KO K18426 > 

RIKEN DNA Bank Human Resource - ECHDC1

Gene ID NCBI Gene 55862 |  KEGG hsa:55862
Gene Symbol ECHDC1
Protein Name ethylmalonyl-CoA decarboxylase 1
Synonyms HEL-S-76|MMCD|dJ351K20.2
Ortholog resource in our bank

  ECHDC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083392 IRAL008H24 pOTB7 BC003549 NM_018479 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084401 M01C011A01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084449 M01C011C01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084497 M01C011E01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084545 M01C011G01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084593 M01C011I01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084641 M01C011K01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084689 M01C011M01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  
HGE084737 M01C011O01 pDONR221 FLJ03-A01 AK025796 ENST00000207783  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR332172 RBb30H04 pGCAP1 NM_001002030.1  
GGAGGCGGAAAAGGAAGTCACCACCGNTGGCCTGCGACGAAATGGCGAAAAGTCTTTTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl