Prev. | 

RIKEN DNA Bank Human Resource - DBNDD2

Gene ID NCBI Gene 55861 |  KEGG hsa:55861
Gene Symbol DBNDD2
Protein Name dysbindin domain containing 2
Synonyms C20orf35|CK1BP|HSMNP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037425 IRAK093J09 pCMV-SPORT6 BC048286 NM_033542 Full
HGY080864 IRAL002C16 pOTB7 BC001105 NM_018478 Partial/var
HGY084341 IRAL010O05 pOTB7 BC012818 NM_018478 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078569 ARe96H01 pKA1U5 NM_001048221.1  
GGGTCCCCCGGGAGCCCTGGAGGCGCAGCCCCACCCCGGCCGGCGCGGCTCGCTCCCACG
HKR218326 ARiS045N14 pGCAP10 NM_001048221.1  
GGCTCGCTCCCACGCCCCCGCCGCGGCCTCGCTGGAGCGGACGGACTGAGTCAGAGGGGG
HKR234972 ARiS087H04 pGCAP10 NM_001048221.1  
GGTCGGTCCCCCGGGAGCCCTGGAGGCGCAGCCCCACCCCGGCCGGCGCGGCTCGCTCCC
HKR234977 ARiS087H09 pGCAP10 NM_001048221.1  
GGTCGGTCCCCCGGGANCCCTGGAGGCGCANCCNNACNNCGGCCGGCGCGNCTCGNTCCN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl