Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACTR10

Gene ID (NCBI) 55860
Gene Symbol ACTR10
Protein Name actin-related protein 10 homolog (S. cerevisiae)
Synonyms ACTR11|Arp11|HARP11
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16576)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008590 IRAK021H22 pCMV-SPORT6 BC011997 NM_018477 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061228 ARe53B04 pKA1U5 NM_018477.2  
GGCCCCGCGAGCGCCGAGACTTGTTGGCCGCGGAGACTGCGACCCTCTTCTCTCAGTCTG
HKR264687 ARiS161L23 pGCAP10 NM_018477.2  
GAGCGCCGGGACTTGTTGGCCGCGGAGACTGCGACCCTCTTCTCTCAGTCTGCCTTACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl