Prev. |  KEGG KO K16576 > 

RIKEN DNA Bank Human Resource - ACTR10

Gene ID NCBI Gene 55860 |  KEGG hsa:55860
Gene Symbol ACTR10
Protein Name actin related protein 10
Synonyms ACTR11|Arp10|Arp11|HARP11
Ortholog resource in our bank

  ACTR10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008590 IRAK021H22 pCMV-SPORT6 BC011997 NM_018477 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061228 ARe53B04 pKA1U5 NM_018477.2  
GGCCCCGCGAGCGCCGAGACTTGTTGGCCGCGGAGACTGCGACCCTCTTCTCTCAGTCTG
HKR264687 ARiS161L23 pGCAP10 NM_018477.2  
GAGCGCCGGGACTTGTTGGCCGCGGAGACTGCGACCCTCTTCTCTCAGTCTGCCTTACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl