Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACOT13

Gene ID (NCBI) 55856
Gene Symbol ACOT13
Protein Name acyl-CoA thioesterase 13
Synonyms PNAS-27|THEM2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17362)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001982 IRAK004P22 pCMV-SPORT6 BC000894 NM_018473 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366459 RBd16C11 pGCAP10 NM_018473.2  
CGGCCGGCCGATGATGCGCGCTTCGTCACAAGGGTGCGAGGAAAGTCAGTGAGCAAATCG
HKR403046 RBdS007K06 pGCAP10 NM_018473.2  
GGCCCTTTGTGTCCTCCTTCTTTCACTAACTTCTGGACTTTCCAGCTCTTCCGAAGTTCG
HKR420702 RBdS051M14 pGCAP10 NM_018473.2  
GGTGTCCTCCTTCTTTCACTAACTTCTGGACTTTCCAGCTCTTCCGAAGTTCGTTCTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl