Prev. | 

RIKEN DNA Bank Human Resource - CISD1

Gene ID NCBI Gene 55847 |  KEGG hsa:55847
Gene Symbol CISD1
Protein Name CDGSH iron sulfur domain 1
Synonyms C10orf70|MDS029|ZCD1|mitoNEET
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086529 IRAL016F09 pDNR-LIB BC007043 NM_018464 Full
HGY088507 IRAL021E11 pDNR-LIB BC005962 NM_018464 Full
HGY088526 IRAL021F06 pDNR-LIB BC008474 NM_018464 Full
HGY088537 IRAL021F17 pDNR-LIB BC059168 NM_018464

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096417 M01C041A17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096465 M01C041C17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096513 M01C041E17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096561 M01C041G17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096609 M01C041I17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096657 M01C041K17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096705 M01C041M17 pDONR221 MGC10-A09 BC007043 NM_018464  
HGE096753 M01C041O17 pDONR221 MGC10-A09 BC007043 NM_018464  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR339255 RBb48C07 pGCAP1 NM_018464.3  
GGTCGGTGCTTTAGTACGCCGCTGGCACCTTTACTCTCGCCGGCCGCGCGAACCCGTTTG
HKR348011 RBb70A11 pGCAP1 NM_018464.3  
GGGTTCCTAGTGCACACGCCTTGCAGCGAGGCGCCATGAGTCTGATCTCAGTTCAGCGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl