Prev. |  KEGG KO K11506 > 

RIKEN DNA Bank Human Resource - CENPN

Gene ID NCBI Gene 55839 |  KEGG hsa:55839
Gene Symbol CENPN
Protein Name centromere protein N
Synonyms BM039|C16orf60|CENP-N|ICEN32
Ortholog resource in our bank

  CENPN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004802 IRAK012A02 pCMV-SPORT6 BC008972 NM_018455
HGY089816 IRAL024I24 pOTB7 BC007334 NM_018455

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045746 ARe14G02 pKA1U5 NM_018455.4  
GGGCTTTGAAGGCGCGGCGAGCGGGAACAGCTCTTGAGGAGTGAGACTGCAGGAGATGTG
HKR432474 RBdS081D02 pGCAP10 NM_018455.4  
GGAGGAGTGAGACTGCAGGAGATGTGGGCCGTGCCAAAGAGATGGATGAGACTGTTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl