Prev. | 

RIKEN DNA Bank Human Resource - EAPP

Gene ID NCBI Gene 55837 |  KEGG hsa:55837
Gene Symbol EAPP
Protein Name E2F associated phosphoprotein
Synonyms BM036|C14orf11
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001910 IRAK004M22 pCMV-SPORT6 BC001245 NM_018453 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064926 ARe62F06 pKA1U5 NM_018453.3  
GAGGGACTGGACTTGCAGTGTAAACAGAGACGCTGCAAATTGCTTGTGGACGGTGTAGGC
HKR173729 ARi34F09 pGCAP10 NM_018453.3  
GCTGGGAACTGGATCTTCCTCAGGAAATGGAAAAGTTGCAACAGCTCCGACAAGGTACTA
HKR416223 RBdS040J07 pGCAP10 NM_018453.3  
TGAGGGACTGGACTTGCAGTGTAAACAGAGACGCTGCAAATTGCTTGTGGACGGTGTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl