Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GLT8D1

Gene ID (NCBI) 55830
Gene Symbol GLT8D1
Protein Name glycosyltransferase 8 domain containing 1
Synonyms AD-017|MSTP139
Databases KEGG hsa:55830 |  NCBI Gene 55830


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040502 ARe01E06 pKA1U5 NM_018446.2  
GGCGGCGCCTGCTTGGCGCGACGCTCTAGCGGNTACCGCTGCGGGCTGGCTGGGCGTAGT
HKR247330 ARiS118F10 pGCAP10 NM_018446.2  
GAGGAGGGCTGCCCCGCGGCGCCTGCTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGC
HKR344881 RBb62D09 pGCAP1 NM_018446.2  
NNGGCTCTNGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl