Prev. |  KEGG KO K14025 > 

RIKEN DNA Bank Human Resource - SELENOS

Gene ID NCBI Gene 55829 |  KEGG hsa:55829
Gene Symbol SELENOS
Protein Name selenoprotein S
Synonyms AD-015|ADO15|SBBI8|SELS|SEPS1|VIMP
Ortholog resource in our bank

  SELENOS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082135 IRAL005F15 pOTB7 BC008759 NM_018445.6
HGY081313 IRAL003E17 pOTB7 BC005840 NM_203472 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235006 ARiS087I14 pGCAP10 NM_018445.4  
GCCGGCTGGAGGCGCGGCGGCAGGGCTGGGCGGCGGCGGCGGCGGCGGTCATGGAACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl