Prev. |  KEGG KO K11795 > 

RIKEN DNA Bank Human Resource - DCAF6

Gene ID NCBI Gene 55827 |  KEGG hsa:55827
Gene Symbol DCAF6
Protein Name DDB1 and CUL4 associated factor 6
Synonyms 1200006M05Rik|ARCAP|IQWD1|MSTP055|NRIP|PC326
Ortholog resource in our bank

  DCAF6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096947 IRAL042G03 pOTB7 BC025262 NM_001017977 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009809 W01A024I17 pENTR-TOPO IRAL042G03 BC025262 NM_001017977  
HGE009813 W01A024I21 pENTR-TOPO IRAL042G03 BC025262 NM_001017977  
HGE009815 W01A024I23 pENTR-TOPO IRAL042G03 BC025262 NM_001017977  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044970 ARe12H02 pKA1U5 NM_018442.2  
GAGGAGAGTATGAGGCGAGCTCCGGCCCGGGTGCGGCCGGGCTTCAGGGGCCCAGGCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl