Prev. |  KEGG KO K07753 > 

RIKEN DNA Bank Human Resource - PECR

Gene ID NCBI Gene 55825 |  KEGG hsa:55825
Gene Symbol PECR
Protein Name peroxisomal trans-2-enoyl-CoA reductase
Synonyms DCRRP|HPDHASE|HSA250303|PVIARL|SDR29C1|TERP
Ortholog resources KEGG ortholog (KEGG orthology K07753) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081846 IRAL004K06 pOTB7 BC002529 NM_018441 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444204 RBdS110I12 pGCAP10 NM_018441.4  
GAGCTGCTCTGGCACCCCGCTGCAGGGATGGCCTCCTGGGCTAAGGGCAGGAGCTACCTG
HKR452919 RBdS132E23 pGCAP10 NM_018441.4  
GCTGAGACCCAGAAGGGCCTGCGCTCAGCTGCTCTGGCACCCCGCTGCAGGGATGGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl