Prev. |  KEGG KO K15601 > 

RIKEN DNA Bank Human Resource - KDM3A

Gene ID NCBI Gene 55818 |  KEGG hsa:55818
Gene Symbol KDM3A
Protein Name lysine demethylase 3A
Synonyms JHDM2A|JHMD2A|JMJD1|JMJD1A|TSGA
Ortholog resource in our bank

  KDM3A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066836 ARe67B12 pKA1U5 NM_018433.4 done
GGGAGTCGGCTAGGCGGCTGGAAACGGCGGCTGCCGCCGGNTGACTCAGGGTAGGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl