Prev. | 

RIKEN DNA Bank Human Resource - PCID2

Gene ID NCBI Gene 55795 |  KEGG hsa:55795
Gene Symbol PCID2
Protein Name PCI domain containing 2
Synonyms F10
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005142 IRAK012O06 pCMV-SPORT6 BC008975 NM_018386
HGX005408 IRAK013I16 pCMV-SPORT6 BC016614 NM_018386 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054908 ARe37E12 pKA1U5 NM_018386.1  
GGCTCTCCGNTTCGGCGGCGCTCCCATGGCGCACATTACCATTAACCAGTACCTGCAGCA
HKR054921 ARe37F01 pKA1U5 NM_018386.1  
GTTTAACTTTTTTAATGATCANNACTATTAAAAACCAGAGTTCTTTGTTTAATCCAANAA
HKR162548 ARi06G04 pGCAP10 NM_018386.1  
CCGTTCGGCGGCGCTCCCATGGCGCACATTACCATTAACCAGTACCTGCAGCAGGTGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl