Prev. |  KEGG KO K14590 > 

RIKEN DNA Bank Human Resource - CMTR2

Gene ID NCBI Gene 55783 |  KEGG hsa:55783
Gene Symbol CMTR2
Protein Name cap methyltransferase 2
Synonyms AFT|FTSJD1|HMTr2|MTr2
Ortholog resource in our bank

  CMTR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013403 IRAK033I11 pBluescriptR BC034468 NM_018348 Full/var
HGY019070 IRAK047L06 pBluescriptR BC035005 NM_018348

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330004 RBb25A04 pGCAP1 NM_018348.5  
TTGGAGTGCCTCCTGGTCCCTGTCTGCCGGCATTCGCGGCTGCGGGGCCCGGAGGTGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl