Prev. |  KEGG KO K10862 > 

RIKEN DNA Bank Human Resource - TDP1

Gene ID NCBI Gene 55775 |  KEGG hsa:55775
Gene Symbol TDP1
Protein Name tyrosyl-DNA phosphodiesterase 1
Synonyms -
Ortholog resource in our bank

  TDP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005868 IRAK014L04 pCMV-SPORT6 BC015474 NM_018319 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022803 W01A057A03 pENTR-TOPO IRAK014L04 BC015474 NM_018319  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166172 ARi15H04 pGCAP10 NM_001008744.1 done
GGGGATCCGAGGCAAGCGTTGGTTCTGTGCGCCTCAGGAGTATAATGTCTCAGGAAGGCG
HKR432673 RBdS081L09 pGCAP10 NM_001008744.1  
TGCCAATCCTGCTTGTGCATGGTGATAAGCGAGAGGCTAAGGCTCACCTCCATGCCCAGG
HKR432757 RBdS081O21 pGCAP10 NM_001008744.1  
TGCCAATCCTGCTTGTGCATGGTGATAAGCGAGAGGCTAAGGCTCACCTCCATGCCCAGG
HKR462616 RBdS156I24 pGCAP10 NM_001008744.1  
GGCGGCGGCCGCCGAAGGGGCGGGATCCGAGGCAAGCGTTGGTTCTGTGCGCCTCAGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl