Prev. |  KEGG KO K01456 > 

RIKEN DNA Bank Human Resource - NGLY1

Gene ID NCBI Gene 55768 |  KEGG hsa:55768
Gene Symbol NGLY1
Protein Name N-glycanase 1
Synonyms CDDG|CDG1V|PNG-1|PNG1|PNGase
Ortholog resource in our bank

  NGLY1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001432 IRAK003J16 pCMV-SPORT6 BC000963 NM_018297
HGY088857 IRAL022C09 pOTB7 BC007226 NM_018297 Full
HGY087123 IRAL017N11 pOTB7 BC017220 NM_018297 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR328001 RBb20A01 pKA1U5 NM_018297.2  
GTCAGTGTGGGACGCGGAGAGCGAGGGGCGGCNNCTGNNGCCCGCTGGCGCTCAAGCATG
HKR343658 RBb59C10 pGCAP1 NM_018297.2  
GGGCGCTCAAGCATGGCGGCGGCGGCATTGGGCAGCTCCTCAGGCTCGGCGTCCCCGGCC
HKR386854 RBd67C06 pGCAP10 NM_018297.2  
GGGCGCTCAAGCATGGCGGCGGCGGCATTGGGCAGCTCCTCAGGCTCGGCGTCCCCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl