Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AJ

Gene ID NCBI Gene 55766 |  KEGG hsa:55766
Gene Symbol H2AJ
Protein Name H2A.J histone
Synonyms H2AFJ
Ortholog resource in our bank

  H2AJ

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082579 IRAL006H11 pOTB7 BC003602 NM_177925 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362170 RBd05H02 pGCAP10 NM_177925.2  
GGCATTCCGGTACCGGACGCCGAGAGCGGTTTGTCTCCGTCTCTGGAGTTGTAGGCGAGA
HKR371321 RBd28F01 pGCAP10 NM_177925.2  
GGCATTCCGGTACCGGACGCCGAGAGCGGTTTGTCTCCGTCTCTGGAGTTGTAGGCGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl