DNA Bank Top |  KEGG KO K19656 > 

RIKEN DNA Bank Human Resource - IFT122

Gene ID NCBI Gene 55764 |  KEGG hsa:55764
Gene Symbol IFT122
Protein Name intraflagellar transport 122
Synonyms CED|CED1|CFAP80|FAP80|SPG|WDR10|WDR10p|WDR140

Link

Ortholog resource in our bank

  IFT122

External database

human IFT122

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB15191 pCAG2-mCherry-C1-IFT122 Expression vector of human intraflagellar transport 122 (IFT122), tagged with N-terminal mCherry, CAG promoter.    
RDB15190 pCAG2-EGFP-C1-IFT122 Expression vector of human intraflagellar transport 122 (IFT122), tagged with N-terminal EGFP, CAG promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080889 IRAL002D17 pOTB7 BC004238 NM_052990 Full
HGY083660 IRAL009C12 pOTB7 BC003045 NM_052990 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365253 RBd13C05 pGCAP10 NM_018262.2  
GAAAGTGGCTTGTGGAGTGGCGACCGTTAGTGAGGCGGTTGCTGAGACAGACGCTGAGGC
HKR380923 RBd52F03 pGCAP10 NM_018262.2  
GGAAGCCGTGATGAGGGCCGTGTTGACGTGGAGAGATAAAGCCGAGCACTGTATAAATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl