Prev. | 

RIKEN DNA Bank Human Resource - CCAR1

Gene ID NCBI Gene 55749 |  KEGG hsa:55749
Gene Symbol CCAR1
Protein Name cell division cycle and apoptosis regulator 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097101 IRAL042M13 pOTB7 BC026036 NM_018237 Partial/var
HGY099235 IRAL048B11 pDNR-LIB BC058846 NM_018237 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203221 ARiS008A21 pGCAP10 NM_018237.2  
GGACGGGTTTGAAATGNCTTCGATGTTAGCCGGGACCCGACTCAGATCGATGCTATAGAA
HKR364503 RBd11E07 pGCAP10 NM_018237.2  
GAAAAGCTGACGGGTTTGAAATGGCTTCGATGTTAGCCGGGACCCGACTCAGATCGATGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl