Prev. |  KEGG KO K08660 > 

RIKEN DNA Bank Human Resource - CNDP2

Gene ID NCBI Gene 55748 |  KEGG hsa:55748
Gene Symbol CNDP2
Protein Name carnosine dipeptidase 2
Synonyms CN2|CPGL|HEL-S-13|HsT2298|PEPA
Ortholog resource in our bank

  CNDP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081767 IRAL004G23 pOTB7 BC001375 NM_018235 Full/var
HGY083830 IRAL009J14 pOTB7 BC003176 NM_018235 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR441840 RBdS104J24 pGCAP10 NM_018235.1  
GGGAACCGGCGCCGCGCTTGCTGCTGGTAACAGGGCCTTGCCTAGTGGGCCTTCCTTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl