Prev. |  KEGG KO K06275 > 

RIKEN DNA Bank Human Resource - PARVA

Gene ID NCBI Gene 55742 |  KEGG hsa:55742
Gene Symbol PARVA
Protein Name parvin alpha
Synonyms CH-ILKBP|MXRA2
Ortholog resource in our bank

  PARVA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087666 IRAL019C18 pDNR-LIB BC014535 NM_018222 Full/var
HGY093178 IRAL032P18 pDNR-LIB BC016713 NM_018222 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040988 W01A102H20 pENTR-TOPO IRAL019C18 BC014535 NM_018222  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040978 ARe02H10 pKA1U5 NM_018222.3  
GAGTCCCGCCGCCGCCCGCTGCGTCCGCCCAGCNCCTTNTCCGCGNTCCCGACCGGCCCG
HKR170131 ARi25F11 pGCAP10 NM_018222.3  
GCTCAGTCCCGCCGCCGCCCGCTGCGTCCGCCCAGCGCCAGCTCCGCGTCCCGACCGGCC
HKR279504 ARiS198M16 pGCAP10 NM_018222.3  
GAGCCTCAGTCCCGCCGCCGCCCGCTGCGTCCGCCCAGCGCCAGCTCCGCGTCCCGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl