Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - ENAH

Gene ID (NCBI) 55740
Gene Symbol ENAH
Protein Name ENAH, actin regulator
Synonyms ENA|MENA|NDPP1
Databases KEGG hsa:55740 |  NCBI Gene 55740
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05746)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056338 IRAK140O02 pCMV-SPORT6 BC065238 NM_018212 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068410 ARe71A10 pKA1U5 NM_018212.4  
GGCGGCTGCAGCAGCTGCCGGTTGCACACGGCCTCGGCGGCGGCGCGGCGAGCGCGGGCC
HKR078459 ARe96C11 pKA1U5 NM_018212.4  
GGGTTCCTCGCGGCGATCCCGACTCTCCTCCCGCGGCTGCAGCAGCTGCCGGTTGCACAC
HKR079635 ARe99B11 pKA1U5 NM_018212.4  
TGAGCTGCCGGTTGCACACGGCCTCGGCGGCGGCGCGGCGAGCGCGGGCCTGTGGAGCGG
HKR405649 RBdS014C01 pGCAP10 NM_018212.4  
GGCGGCGATCCCGACTCTCCTCCCGCGGCTGCAGCAGCTGCCGGTTGCACACGGCCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl