Prev. |  KEGG KO K09531 > 

RIKEN DNA Bank Human Resource - DNAJC11

Gene ID NCBI Gene 55735 |  KEGG hsa:55735
Gene Symbol DNAJC11
Protein Name DnaJ heat shock protein family (Hsp40) member C11
Synonyms dJ126A5.1
Ortholog resource in our bank

  DNAJC11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081944 IRAL004O08 pOTB7 BC008772 NM_018198 Partial/var
HGY087469 IRAL018L05 pOTB7 BC006086 NM_018198 Full/var
HGY092359 IRAL030O23 pOTB7 BC014145 NM_018198 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR360925 RBd02F05 pGCAP10 NM_018198.2  
GGAAGATGGCGACGGCCTTGAGCGAGGAGGAGCTGGACAATGAAGACTATTACTCGTTGC
HKR360931 RBd02F11 pGCAP10 NM_018198.2  
GGAAGATGGCGACGGCCTTGAGCGAGGAGGAGCTGGACAATGAAGACTATTACTCGTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl