RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - N4BP2

Gene ID	NCBI Gene 55728 \| KEGG hsa:55728
Gene Symbol	N4BP2
Protein Name	NEDD4 binding protein 2
Synonyms	B3BP

Ortholog resource in our bank

  N4BP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR209244	ARiS023B20	pGCAP10	NM_001318359.2	full/var
HKR209244	GGCGCGGCGCGGGAGAGCGCAGTGGCGCCGGCGGGAAAGGGCTGCGGACCTGCGGCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl