Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - N4BP2

Gene ID (NCBI) 55728
Gene Symbol N4BP2
Protein Name NEDD4 binding protein 2
Synonyms B3BP
Databases KEGG hsa:55728 |  NCBI Gene 55728
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15720)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209244 ARiS023B20 pGCAP10 NM_018177.3  
GGCGCGGCGCGGGAGAGCGCAGTGGCGCCGGCGGGAAAGGGCTGCGGACCTGCGGCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl