Prev. |  KEGG KO K10753 > 

RIKEN DNA Bank Human Resource - ASF1B

Gene ID NCBI Gene 55723 |  KEGG hsa:55723
Gene Symbol ASF1B
Protein Name anti-silencing function 1B histone chaperone
Synonyms CIA-II
Ortholog resource in our bank

  ASF1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019164 IRAK047P04 pBluescriptR BC036521 NM_018154 Full
HGY087142 IRAL017O06 pOTB7 BC007726 NM_018154 Full
HGY090776 IRAL026P16 pOTB7 BC010014 NM_018154 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380522 RBd51F02 pGCAP10 NM_018154.2  
TGAGTTCTCGGAGAGAAGAGGCGGGAGTGGACCTGGTCAGCCCTACCCCACTGACCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl