Prev. |  KEGG KO K01870 > 

RIKEN DNA Bank Human Resource - IARS2

Gene ID NCBI Gene 55699 |  KEGG hsa:55699
Gene Symbol IARS2
Protein Name isoleucyl-tRNA synthetase 2, mitochondrial
Synonyms CAGSSS|ILERS
Ortholog resource in our bank

  IARS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007663 IRAK019C15 pCMV-SPORT6 BC010218 NM_018060 Partial
HGX011865 IRAK029L01 pCMV-SPORT6 BC040376 NM_018060 Partial
HGX042836 IRAK107B12 pCMV-SPORT6 BC047880 NM_018060 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164903 ARi12E07 pGCAP10 NM_018060.3 done
GGCGCCCTCTTACTCGGCTCCCCTTGGTTTCCTGGGGTCCTGCCCCTTCAAGCTGGGGCG
HKR444027 RBdS110B03 pGCAP10 NM_018060.3 done
GGTCCTGCCCCTTCAAGCTGGGGCGGGAGCGGAGGACCCCGCTCTCAGGGGTTGCCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl