Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NSUN5

Gene ID (NCBI) 55695
Gene Symbol NSUN5
Protein Name NOP2/Sun domain family, member 5
Synonyms NOL1|NOL1R|NSUN5A|WBSCR20|WBSCR20A|p120
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15264)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171601 ARi29A01 pGCAP10 NM_018044.2  
GGGGAACATGGGGCTGTACGCTGCGGTGGCAGGCGTGCTGGCCGGCGTGGAGAGCCGCCA
HKR174410 ARi36A10 pGCAP10 NM_018044.2  
GACAGAGCCGTAAAGGCGCGCGGGAACATGGGGCTGTATGCTGCAGCTGCAGGCGTGTTG
HKR405762 RBdS014G18 pGCAP10 NM_018044.2  
TGGCCGAGCCGGGTGCGTTTTGCCACAGAGCCGTAAAGGCGCGCGGGAACATGGGGCTGT
HKR428354 RBdS070O18 pGCAP10 NM_018044.2  
GGGGAACATGGGGCTGTATGCTGCAGCTGCAGGCGTGTTGGCCGGCGTGGAGAGCCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl