Prev. |  KEGG KO K17491 > 

RIKEN DNA Bank Human Resource - PPP4R3A

Gene ID NCBI Gene 55671 |  KEGG hsa:55671
Gene Symbol PPP4R3A
Protein Name protein phosphatase 4 regulatory subunit 3A
Synonyms FLFL1|KIAA2010|MSTP033|PP4R3|PP4R3A|SMEK1|smk-1|smk1
Ortholog resource in our bank

  PPP4R3A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04838 SEREX clone NGO-Pr-181 5' (ID 2535); NGO-Pr-181 3' (ID 2536) #1 SEREX clone NGO-Pr-181 5' (ID 2535); NGO-Pr-181 3' (ID 2536) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027952 IRAK069O16 pCMV-SPORT6 BC038932 NM_032560 Partial/var
HGX069813 IRAK174I21 pCMV-SPORT6 BC072409 NM_032560 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR396580 RBd91H12 pGCAP10 NM_032560.4  
GGCCCCGTTTTTGAGGGGCGAACCAAGATGGCGGCGGTTTTGGCTGTGTGAGGAAGACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl