Prev. |  KEGG KO K13181 > 

RIKEN DNA Bank Human Resource - DDX27

Gene ID NCBI Gene 55661 |  KEGG hsa:55661
Gene Symbol DDX27
Protein Name DEAD-box helicase 27
Synonyms DRS1|Drs1p|HSPC259|PP3241|RHLP|dJ686N3.1
Ortholog resource in our bank

  DDX27

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090609 IRAL026I17 pOTB7 BC009304 NM_017895 Partial/var
HGY091552 IRAL028O16 pOTB7 BC011927 NM_017895 Partial
HGY093946 IRAL034O10 pOTB7 BC016060 NM_017895 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172970 ARi32H02 pGCAP10 NM_017895.6  
GGCTTCCGGAAGTGGCTTCTGCGACAACATGCTTGCGGACCTCGGCTTAATCGGAACCAT
HKR180884 ARi52D12 pGCAP10 NM_017895.6  
GGCTCGCTTCCGGAAGTGGCTTCTGCGACAACATGCTTGCGGACCTCGGCTTAATCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl