Prev. |  KEGG KO K01409 > 

RIKEN DNA Bank Human Resource - OSGEP

Gene ID NCBI Gene 55644 |  KEGG hsa:55644
Gene Symbol OSGEP
Protein Name O-sialoglycoprotein endopeptidase
Synonyms GAMOS3|GCPL1|KAE1|OSGEP1|PRSMG1|TCS3
Ortholog resources KEGG ortholog (KEGG orthology K01409) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025843 IRAK064K03 pCMV-SPORT6 BC032310 NM_017807 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR342051 RBb55C03 pGCAP1 NM_017807.2  
ATCTGCAGGCTGGCCAGCTTCCTCTGCGCTCCGGAAAGCTGCGGCCCAGCGCGGACTAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl