Prev. |  KEGG KO K14437 > 

RIKEN DNA Bank Human Resource - CHD7

Gene ID NCBI Gene 55636 |  KEGG hsa:55636
Gene Symbol CHD7
Protein Name chromodomain helicase DNA binding protein 7
Synonyms CRG|HH5|IS3|KAL5
Ortholog resources KEGG ortholog (KEGG orthology K14437) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046274 IRAK115L10 pCMV-SPORT6 BC053890 NM_017780 Partial
HGX056020 IRAK140A20 pCMV-SPORT6 BC068000 NM_017780 Partial
HGY097215 IRAL043A15 pOTB7 BC033116 NM_017780 Partial/var
HGY097611 IRAL044A11 pOTB7 BC041018 NM_017780 Partial/var
HGY098821 IRAL047A21 pOTB7 BC051264 NM_017780 Partial
HGY103852 IRAL059K12 pOTB7 BC080627 NM_017780 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR334003 RBb35A03 pGCAP1 NM_017780.2  
GGAGCGCGAGCGCGTTTCCTCCCGCCGGCGCCGAGCACGAGTTGCCGGCTCCATTCGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl