Prev. | 

RIKEN DNA Bank Human Resource - DEPDC1

Gene ID NCBI Gene 55635 |  KEGG hsa:55635
Gene Symbol DEPDC1
Protein Name DEP domain containing 1
Synonyms DEP.8|DEPDC1-V2|DEPDC1A|SDP35
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090834 IRAL027B10 pOTB7 BC011743 NM_017779 Partial/var
HGY095612 IRAL039A12 pOTB7 BC035506 NM_017779 Partial/var
HGY097710 IRAL044E14 pOTB7 BC041580 NM_017779 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173231 ARi33B07 pGCAP10 NM_017779.4  
CGGCCGGCCGATGTTTCGCCGCCATGGACGCCACCGGGCGCTGACAGACCTATGGAGAGT
HKR264470 ARiS161C22 pGCAP10 NM_017779.4  
TGGTGCCGAGACTCGCCACTGCCGCGGCCGCTGGGCCTGAGTGTCCCCTTCNCCGCCATG
HKR409181 RBdS022P21 pGCAP10 NM_017779.4  
GGTGCCGAGACTCGCCACTGCCGCGGCCGCTGGGCCTGAGTGTCGCCTTCGCCGCCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl