Prev. |  KEGG KO K14710 > 

RIKEN DNA Bank Human Resource - SLC39A4

Gene ID NCBI Gene 55630 |  KEGG hsa:55630
Gene Symbol SLC39A4
Protein Name solute carrier family 39 member 4
Synonyms AEZ|AWMS2|ZIP4
Ortholog resource in our bank

  SLC39A4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027477 IRAK068L13 pCMV-SPORT6 BC033807 NM_130849 Partial/var
HGY081458 IRAL003K18 pOTB7 BC001688 NM_130849 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047676 ARe19D04 pKA1U5 NM_130849.2  
GACTCAAGGCTCCTCCCAGGTGGCGGAGGAGAGCCCGGAGCTGCTGAACCCTGAGCCCAG
HKR346950 RBb67G06 pGCAP1 NM_130849.2  
ACTTACTCAAGGCTCCTCCCAGGTGGCGGAGGAGAGCCCGGAGCTGCTGAACCCTGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl