Prev. |  KEGG KO K18751 > 

RIKEN DNA Bank Human Resource - PNRC2

Gene ID NCBI Gene 55629 |  KEGG hsa:55629
Gene Symbol PNRC2
Protein Name proline rich nuclear receptor coactivator 2
Synonyms -
Ortholog resource in our bank

  PNRC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067172 IRAK167P12 pBluescriptR BC068475 NM_017761 Full/var
HGX069970 IRAK174P10 pCMV-SPORT6 BC078177 NM_017761 Full
HGY083381 IRAL008H13 pOTB7 BC001959 NM_017761
HGY103979 IRAL059P19 pOTB7 BC085018 NM_017761 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004291 W01A010M03 pENTR-TOPO IRAL008H13 BC001959 NM_017761  
HGE028320 W01A070N08 pENTR-TOPO flj0051j01 AK000319 NM_017761  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042034 ARe05B10 pKA1U5 NM_017761.2  
TGGTCGGTAGAGGCAGAAGGAGAAGGTCGGGTTGTAGAAGCTGGGGTGGCCGGCAGCTCG
HKR219719 ARiS049E23 pGCAP10 NM_017761.2  
GGTCGGTAGAGGCAGAAGGAGAAGGTCGGGTTGTAGAAGCTGGGGTGGCCGGCAGCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl