Prev. |  KEGG KO K20029 > 

RIKEN DNA Bank Human Resource - ZDHHC7

Gene ID NCBI Gene 55625 |  KEGG hsa:55625
Gene Symbol ZDHHC7
Protein Name zinc finger DHHC-type palmitoyltransferase 7
Synonyms DHHC7|SERZ-B|SERZ1|ZNF370
Ortholog resource in our bank

  ZDHHC7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010828 IRAK027B04 pCMV-SPORT6 BC017702 NM_017740 Partial
HGY096243 IRAL040K03 pOTB7 BC018772 NM_017740 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021813 W01A054I21 pENTR-TOPO flj0051g18 AK000286 NM_017740  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184154 ARi60G10 pGCAP10 NM_017740.1  
GGCTCTCCAGCCAAGGCTCCGGGCTGAGGCATTTGCTTGGCTGCAGCCTCCTTCCGACCT
HKR376410 RBd41A10 pGCAP10 NM_017740.1  
GGCACCGCCCCGCTCTCCAGCCAAGGCTCCGGGCTGAGGCATTTGCTTGGCTGCAGCCTC
HKR444042 RBdS110B18 pGCAP10 NM_017740.1  
GCTCTCCAGCCAAGGCTCCGGGCTGAGGCATTTGCTTGGCTGCAGCCTCCTTCCGACCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl