Prev. |  KEGG KO K09602 > 

RIKEN DNA Bank Human Resource - OTUB1

Gene ID NCBI Gene 55611 |  KEGG hsa:55611
Gene Symbol OTUB1
Protein Name OTU deubiquitinase, ubiquitin aldehyde binding 1
Synonyms HSPC263|OTB1|OTU1
Ortholog resources KEGG ortholog (KEGG orthology K09602) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084334 IRAL010N22 pOTB7 BC007519 NM_017670 Full/var
HGY087964 IRAL019P04 pDNR-LIB BC010368 NM_017670 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055370 ARe38H02 pKA1U5 NM_017670.2  
GGGTCGGTAGTGCGGCGCTGTTTAAAGATGGCNGCTGAGGAACCTCAGCAGCAGAAGCAG
HKR080571 ARf01H03 pKA1U5 NM_017670.2  
GGCTGTTTAAAGATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGCCGCTGGGCAGC
HKR166500 ARi16E04 pGCAP10 NM_017670.2  
GGGTAGTGCGGCGCTGTTTAAAGATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGC
HKR180027 ARi50B03 pGCAP10 NM_017670.2  
ATGGCTGTTTAAAGATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGCCGCTGGGCA
HKR181776 ARi54H08 pGCAP10 NM_017670.2  
GAGTGCGGCGCTGTTTAAAGATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGCCGC
HKR277679 ARiS194D07 pGCAP10 NM_017670.2  
GAGTGCGGCGCTGTTTAAAGATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGCCGC
HKR375608 RBd39A08 pGCAP10 NM_017670.2  
GGCGGCGCTGTTTAAAGATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGCCGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl