Prev. |  KEGG KO K21245 > 

RIKEN DNA Bank Human Resource - SUPT20H

Gene ID NCBI Gene 55578 |  KEGG hsa:55578
Gene Symbol SUPT20H
Protein Name SPT20 homolog, SAGA complex component
Synonyms C13|C13orf19|FAM48A|FP757|P38IP|SPT20
Ortholog resource in our bank

  SUPT20H

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052925 ARe32F05 pKA1U5 NM_017569.3  
GGGAACTGGCTGTTGGTGGGGGTGCAGCACTGAGCCGCCGACGGGGCGGGTGGGCTTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl