Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAGK

Gene ID (NCBI) 55577
Gene Symbol NAGK
Protein Name N-acetylglucosamine kinase
Synonyms GNK|HSA242910
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00884)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082026 IRAL005B02 pOTB7 BC001029 NM_017567 Full
HGY086723 IRAL016N11 pDNR-LIB BC005371 NM_017567 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025149 W01A062O13 pENTR-TOPO IRAL005B02 BC001029 NM_017567  
HGE025151 W01A062O15 pENTR-TOPO IRAL005B02 BC001029 NM_017567  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062079 ARe55D07 pKA1U5 NM_017567.3 done
TTGACTGCCAGCAACTTCCGGGCGTTTACAGGCNGGNAGGTGCTCAGCAGGGAGACCCCC
HKR218066 ARiS045C18 pGCAP10 NM_017567.3  
AAAACNGCGGNACCAGCNGCNACGGTAGCAGCAGCATGGCCGCGATCTATGGGGGTGTAG
HKR371609 RBd29A09 pGCAP10 NM_017567.3  
GGGAGGGAAGGAGGTGTCAGGCGGGGAGAGACGCAAACGGCGGGACCAGCAGCGACGGTA
HKR475087 RBdS187L23 pGCAP10 NM_017567.3 done
GGGAGGGAAGGAGGTGTCAGGCGGGGAGAGACGCAAACGGCGGGACCAGCAGCGACGGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.09.08

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170829.pl