Prev. |  KEGG KO K18166 > 

RIKEN DNA Bank Human Resource - FOXRED1

Gene ID NCBI Gene 55572 |  KEGG hsa:55572
Gene Symbol FOXRED1
Protein Name FAD dependent oxidoreductase domain containing 1
Synonyms FP634|H17|MC1DN19
Ortholog resources KEGG ortholog (KEGG orthology K18166) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086351 IRAL015O15 pOTB7 BC002910 NM_017547 Partial
HGY090260 IRAL025K20 pOTB7 BC013902 NM_017547 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040449 ARe01C01 pKA1U5 NM_017547.2  
GGATAATAGCGAGGCAGCAGTGCAGCTTTCAGAGGGTCCGGGCTCAGAGGGGCTATGATT
HKR370082 RBd25D10 pGCAP10 NM_017547.2  
GGGGCCGCTGGCCAATTGGCGCGCTCGTCTGAATGGCGTTTGGCGCGGAGCAGTGACGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl