Prev. | 

RIKEN DNA Bank Human Resource - CDCA7L

Gene ID NCBI Gene 55536 |  KEGG hsa:55536
Gene Symbol CDCA7L
Protein Name cell division cycle associated 7 like
Synonyms JPO2|R1|RAM2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027704 IRAK069E08 pCMV-SPORT6 BC032576 NM_018719 Full/var
HGX033955 IRAK084O19 pCMV-SPORT6 BC039823 NM_018719
HGY084336 IRAL010N24 pOTB7 BC014630 NM_018719 Partial
HGY090704 IRAL026M16 pOTB7 BC009352 NM_018719 Full
HGY096955 IRAL042G11 pOTB7 BC025242 NM_018719 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070854 ARe77C06 pKA1U5 NM_018719.3  
GGGAGCGCGCCTAGCTGCTCGGGCGCGGGGCGCNTCTTTGGTTGCGCCGGGCCGGTGNTG
HKR219613 ARiS049A13 pGCAP10 NM_018719.3  
GGCTCCGGGCGGAGCGCGCTAGCTGCTCGGGCGCGGGGCGTTCTTGGTGCGCCGGGCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl