Prev. |  KEGG KO K15791 > 

RIKEN DNA Bank Human Resource - DHTKD1

Gene ID NCBI Gene 55526 |  KEGG hsa:55526
Gene Symbol DHTKD1
Protein Name dehydrogenase E1 and transketolase domain containing 1
Synonyms AMOXAD|CMT2Q
Ortholog resource in our bank

  DHTKD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082226 IRAL005J10 pOTB7 BC002477 NM_018706 Full/var
HGY088318 IRAL020N06 pOTB7 BC007955 NM_018706 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100038 M01C050B14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100086 M01C050D14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100134 M01C050F14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100182 M01C050H14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100230 M01C050J14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100278 M01C050L14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100326 M01C050N14 pDONR221 MGC14-H07 BC002477 ENST00000379076  
HGE100374 M01C050P14 pDONR221 MGC14-H07 BC002477 ENST00000379076  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234135 ARiS085F15 pGCAP10 NM_018706.5  
GGAGTCCCGGATTTACCAGGGCCGGTGGGATCCCCTCGGGCTCCCGCCTTAGCATGCTGG
HKR390830 RBd77B06 pGCAP10 NM_018706.5  
GGCCGGTGGGATCCCCTCGGGCTCCCGCCTTAGCATGCTGGCCGGGACATCTGGTGAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl