Prev. |  KEGG KO K09087 > 

RIKEN DNA Bank Human Resource - HES6

Gene ID NCBI Gene 55502 |  KEGG hsa:55502
Gene Symbol HES6
Protein Name hes family bHLH transcription factor 6
Synonyms C-HAIRY1|HES-6|bHLHb41|bHLHc23
Ortholog resource in our bank

  HES6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088172 IRAL020H04 pOTB7 BC007939 NM_018645

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000730 W01A001N18 pENTR-TOPO IRAL020H04 BC007939 NM_018645  
HGE000732 W01A001N20 pENTR-TOPO IRAL020H04 BC007939 NM_018645  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322977 RBb07H09 pKA1U5 NM_018645.3  
GAAGCCGCGAGGAGCGCGGACGGCTGGGCTGCTGCTGGGCGGCCGCGGGGCAGCGGAGGG
HKR430157 RBdS075G13 pGCAP10 NM_018645.3  
TGAAGCCGCGAGGAGCGCGGACGGCTGGGCTGCTGCTGGGCGGCCGCGGGGCAGCGGAGG
HKR442134 RBdS105F14 pGCAP10 NM_018645.3  
GAAGCCGCGAGGAGCGCGGACGGCTGGGCTGCTGCTGGGCGGCCGCGGGGCAGCGGAGGG
HKR452914 RBdS132E18 pGCAP10 NM_018645.3  
GAGCCGCGAGGAGCGCGGACGGCTGGGCTGCTGCTGGGCGGCCGCGGGGCAGCGGAGGGC
HKR462411 RBdS156A11 pGCAP10 NM_018645.3  
GAGCCGCGAGGAGCGCGGACNGCTGGGCTGCTGCTGGGCGGCCGCGGGGCAGCGGANGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl