Prev. |  KEGG KO K04742 > 

RIKEN DNA Bank Human Resource - CHST12

Gene ID NCBI Gene 55501 |  KEGG hsa:55501
Gene Symbol CHST12
Protein Name carbohydrate sulfotransferase 12
Synonyms C4S-2|C4ST-2|C4ST2
Ortholog resource in our bank

  CHST12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086064 IRAL015C16 pOTB7 BC002918 NM_018641 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080412 ARf01A12 pKA1U5 NM_018641.3  
GGGGGCTCCTGCGCCGGGGGCGGGGCCGGCGAGGGCTGCCTCTGGGGGGTCCGCTAGTCG
HKR168174 ARi20H06 pGCAP10 NM_018641.3  
GCGGCGAGGGCTGCCTCTGGGGGGTCCGCTAGTCGCGGGGCGGCGGCGGCGGCTGCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl