Prev. |  KEGG KO K09505 > 

RIKEN DNA Bank Human Resource - DNAJA4

Gene ID NCBI Gene 55466 |  KEGG hsa:55466
Gene Symbol DNAJA4
Protein Name DnaJ heat shock protein family (Hsp40) member A4
Synonyms MST104|MSTP104|PRO1472
Ortholog resource in our bank

  DNAJA4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018893 IRAK047D21 pBluescriptR BC021720 NM_018602 Full/var
HGY019389 IRAK048H21 pBluescriptR BC031044 NM_018602 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177658 ARi44C10 pGCAP10 NM_018602.3  
GCTAGTGCGGTGGAGCCAGGCGTGGAAGTCGGTCCGGCGCGGGGCGGGGGGCGGGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl