Prev. |  KEGG KO K17532 > 

RIKEN DNA Bank Human Resource - STRADB

Gene ID NCBI Gene 55437 |  KEGG hsa:55437
Gene Symbol STRADB
Protein Name STE20 related adaptor beta
Synonyms ALS2CR2|CALS-21|ILPIP|ILPIPA|PAPK|PRO1038
Ortholog resource in our bank

  STRADB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089535 IRAL023N23 pOTB7 BC008302 NM_018571 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006674 W01A016L10 pENTR-TOPO IRAL023N23 BC008302 NM_018571  
HGE006678 W01A016L14 pENTR-TOPO IRAL023N23 BC008302 NM_018571  
HGE006680 W01A016L16 pENTR-TOPO IRAL023N23 BC008302 NM_018571  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276433 ARiS191B09 pGCAP10 NM_018571.5  
GCCCGGCGCGGGTGGGGCGAATGCGTTCCCAGCGGGTAGCCTGGGGCTGGTGCAGAGTTC
HKR277948 ARiS194O12 pGCAP10 NM_018571.5  
GGCAGAGTTCCAAGCCCACGGCCCCGGTCGCGGCCTCGCCGCCCTCCCGCGCCCCGCGCC
HKR346860 RBb67C12 pGCAP1 NM_018571.5  
TTGAGAGTTCCAAGCCCACGGCCCCGGTCGCGGCCTCGCCGCCCTCCCGCGCCCCGCGCC
HKR442081 RBdS105D09 pGCAP10 NM_018571.5  
GGGGGCGAATGCGTTCCCAGCGGGTAGCCTGGGGCTGGTGCAGAGTTCCAAGCCCACGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl