Prev. | 

RIKEN DNA Bank Human Resource - PPP4R1L

Gene ID NCBI Gene 55370 |  KEGG hsa:55370
Gene Symbol PPP4R1L
Protein Name protein phosphatase 4 regulatory subunit 1 like (pseudogene)
Synonyms C20orf192|PPP4R1P1|PRO1085
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168152 ARi20G08 pGCAP10 NR_003505.2  
GCCCGCCTCCATGCCCATCCCAAGATGGCGGAGATCCCCCTGTACTTTGTGGACTTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl