Prev. |  KEGG KO K10130 > 

RIKEN DNA Bank Human Resource - PIDD1

Gene ID NCBI Gene 55367 |  KEGG hsa:55367
Gene Symbol PIDD1
Protein Name p53-induced death domain protein 1
Synonyms LRDD|PIDD
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human
Ortholog resource in our bank

  PIDD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006065 IRAK015C17 pCMV-SPORT6 BC014904 NM_145887 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR389679 RBd74D07 pGCAP10 NM_018494.3  
GAGCCACCCTTTGCGCGCCGCCTGCAGCGCAGCTTCCCCGGGCGCTGCCTGGACAGGCCT
HKR391703 RBd79E07 pGCAP10 NM_018494.3  
GGAAAGGCCGGGAGAGGTTTCCTCCGGGGCTCACGAATTGGGGTCCCGGCCCCAGGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl