Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PIDD1

Gene ID (NCBI) 55367
Gene Symbol PIDD1
Protein Name p53-induced death domain protein 1
Synonyms LRDD|PIDD
Databases KEGG hsa:55367 |  NCBI Gene 55367
Featured content NF-kappa B signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10130)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006065 IRAK015C17 pCMV-SPORT6 BC014904 NM_145887 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR389679 RBd74D07 pGCAP10 NM_018494.3  
GAGCCACCCTTTGCGCGCCGCCTGCAGCGCAGCTTCCCCGGGCGCTGCCTGGACAGGCCT
HKR391703 RBd79E07 pGCAP10 NM_018494.3  
GGAAAGGCCGGGAGAGGTTTCCTCCGGGGCTCACGAATTGGGGTCCCGGCCCCAGGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl