Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - COPRS

Gene ID (NCBI) 55352
Gene Symbol COPRS
Protein Name coordinator of PRMT5, differentiation stimulator
Synonyms C17orf79|COPR5|HSA272196|TTP1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008765 IRAK021P05 pCMV-SPORT6 BC012386 NM_018405

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168404 ARi21A04 pGCAP10 NM_018405.3  
GGCGTCACGTGGCCCACGGCGTCCAGGGCGACCAGCCGCGGGCCGCAGGGCATGGACCTT
HKR203574 ARiS008P14 pGCAP10 NM_018405.3  
GACGGCGTCCAGGGCNACCAGCCGCGGGCCGCAGGGCATGGACCTTCAGGCCGCCGGGGC
HKR346425 RBb66B01 pGCAP1 NM_018405.3  
GCTTCAGGCCGCCGGGGCCCAGGCGCAGGGGGCCGCGGAGCCGTCTCGGGGCCCGCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl