Prev. | 

RIKEN DNA Bank Human Resource - DRAM1

Gene ID NCBI Gene 55332 |  KEGG hsa:55332
Gene Symbol DRAM1
Protein Name DNA damage regulated autophagy modulator 1
Synonyms DRAM
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07412 pGL4-phDRAM Promoter collection, Human DRAM1 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010549 IRAK026G05 pCMV-SPORT6 BC013773 NM_018370 Full
HGX011269 IRAK028C21 pCMV-SPORT6 BC018435 NM_018370 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043249 ARe08C01 pKA1U5 NM_018370.2  
ATCCTGGGGGGCTGGGCCTGCCCCGGCCGTCNCGGAGCCTCCCCTCCCACCGTCCGTGAG
HKR045753 ARe14G09 pKA1U5 NM_018370.2  
GCTCCAGAGTTGCGCAAGAGCCAGCGCGGTAGGGCCAGAGTGGGAAGGCCAGAGCGGGCG
HKR082523 ARf06F03 pKA1U5 NM_018370.2  
ATCCTGAGGTCCCACCGNTCCGTGAGTGTACGCGCCCGGCCGCCGCCTCCAGGCAGCCCG
HKR209223 ARiS023A23 pGCAP10 NM_018370.2  
GAGTCGCGTCCGCTTGGANCTCGCCGGGCGCCTCCGACCCTGCCGGGCCGCTTTGTGACT
HKR219783 ARiS049H15 pGCAP10 NM_018370.2  
AAGCACCGTCCGTGAGTGTACCCGCCCGGCCGCCNNCTCCAGGCCGCCNGGAGCNANNNN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl