Prev. |  KEGG KO K19007 > 

RIKEN DNA Bank Human Resource - AGPAT5

Gene ID NCBI Gene 55326 |  KEGG hsa:55326
Gene Symbol AGPAT5
Protein Name 1-acylglycerol-3-phosphate O-acyltransferase 5
Synonyms 1AGPAT5|LPAATE
Ortholog resource in our bank

  AGPAT5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067486 IRAK168L22 pBluescriptR BC068519 NM_018361 Partial
HGY091108 IRAL027M20 pOTB7 BC023550 NM_018361 Full
HGY103715 IRAL059E19 pOTB7 BC080537 NM_018361 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024998 W01A062I06 pENTR-TOPO IRAL027M20 BC023550 NM_018361  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044808 ARe12A08 pKA1U5 NM_018361.3  
GGTTGCCGCGGCAGCCCCCTGCCCCGGCAGGGGGATGTGGCGATGGGTGAGGGTCATGGG
HKR186012 ARi65A12 pGCAP10 NM_018361.3  
GTCGCTGCCGCCGAGCTGAGANATGCTGCTGTCCTGGTGCTCACACGTACTCATGCGCTA
HKR378050 RBd45C02 pGCAP10 NM_018361.3  
GGGGGAGGGCTAGCGGGGATGGCTGCCGCCGAACTGAGAAGATGCTGCTGTCCCTGGTGC
HKR462471 RBdS156C23 pGCAP10 NM_018361.3  
GGGAGCCCCCTGCCCCGGCAGGGGGATGTGGCGATGGGTGAGGGTCATGGGGTGNAANCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl